Stem-loop sequence ppy-mir-128-2

AccessionMI0014819 (change log)
DescriptionPongo pygmaeus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u ug       a          aua      ac    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 111073058-111073141 [-]
intergenic
Database links

Mature sequence ppy-miR-128

Accession MIMAT0002231
Previous IDsppy-miR-128a
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Evidence not experimental

References

1