Stem-loop sequence ppy-mir-126

AccessionMI0014818 (change log)
DescriptionPongo pygmaeus miR-126 stem-loop
Gene family MIPF0000115; mir-126
Stem-loop
   cgcug c     - a           u       c cug   c 
5'      g gacgg g cauuauuacuu ugguacg g   uga a
        | ||||| | ||||||||||| ||||||| |   |||  
3'      c cugcc c guaauaaugag gccaugc c   acu c
   ---ca -     g -           u       u -aa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 133658664-133658744 [+]
intergenic
Database links

Mature sequence ppy-miR-126

Accession MIMAT0015750
Sequence

52 - 

ucguaccgugaguaauaaugcg

 - 73

Get sequence
Evidence not experimental

References

1