Stem-loop sequence ppy-mir-125a

AccessionMI0014817 (change log)
DescriptionPongo pygmaeus miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u     u u     uc  ug   c    ua        ----  a 
5'  gccag c cuagg  cc  aga ccuu  accuguga    gg c
    ||||| | |||||  ||  ||| ||||  ||||||||    ||  
3'  cgguc g ggucc  gg  ucu ggag  uggacacu    cc a
   c     u c     ga  gu   u    --        ggga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 53227066-53227151 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-125a
ppy-let-7echr19: 53226596-53226674 [+]
ppy-mir-125achr19: 53227066-53227151 [+]
Database links

Mature sequence ppy-miR-125a-5p

Accession MIMAT0015748
Sequence

15 - 

ucccugagacccuuuaaccuguga

 - 38

Get sequence
Evidence not experimental

Mature sequence ppy-miR-125a-3p

Accession MIMAT0015749
Sequence

53 - 

acaggugagguucuugggagcc

 - 74

Get sequence
Evidence not experimental

References

1