Stem-loop sequence ppy-mir-124-2

AccessionMI0014816 (change log)
DescriptionPongo pygmaeus miR-124-2 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   u    -   c    - c        a   ga        uaaug 
5'  gagg gcc cucu g guguucac gcg  ccuugauu     u
    |||| ||| |||| | |||||||| |||  ||||||||      
3'  cucc cgg gaga c cguaagug cgc  ggaauuaa     c
   c    g   a    a -        g   ac        cauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr20: 61545524-61545610 [+]
intergenic
Database links

Mature sequence ppy-miR-124

Accession MIMAT0015747
Sequence

53 - 

uaaggcacgcggugaaugcc

 - 72

Get sequence
Evidence not experimental

References

1