Stem-loop sequence ppy-mir-122

AccessionMI0014815 (change log)
DescriptionPongo pygmaeus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
   c        -      gg       c           --u  c 
5'  cuuagcag agcugu  aguguga aaugguguuug   gu u
    |||||||| ||||||  ||||||| |||||||||||   ||  
3'  ggaucguc ucgaua  ucacacu uuaccgcaaac   ca a
   c        a      aa       a           uau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr18: 71133225-71133309 [+]
intergenic
Database links

Mature sequence ppy-miR-122

Accession MIMAT0015746
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Evidence not experimental

References

1