Stem-loop sequence ppy-mir-105-2

AccessionMI0014814 (change log)
DescriptionPongo pygmaeus miR-105-2 stem-loop
Gene family MIPF0000074; mir-105
Stem-loop
   ugu         u  a          uc        g ug 
5'    gcaucgugg ca augcucagac  cuguggug c  c
      ||||||||| || ||||||||||  |||||||| |  u
3'    ugugguauc gu uacgaguuug  ggcaccac g  u
   auc         -  g          ua        - ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 152526476-152526556 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-105-2
ppy-mir-105-2chrX: 152526476-152526556 [-]
ppy-mir-767chrX: 152525486-152525594 [-]
ppy-mir-105-1chrX: 152524289-152524369 [-]
Database links

Mature sequence ppy-miR-105

Accession MIMAT0002450
Sequence

13 - 

ucaaaugcucagacuccuguggu

 - 35

Get sequence
Evidence not experimental

References

1