Stem-loop sequence ppy-mir-103-2

AccessionMI0014813 (change log)
DescriptionPongo pygmaeus miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   uu  g      --   u  u           ----    ua 
5'   gu cuuuca  gcu cu uacagugcugc    cuug  g
     || ||||||  ||| || |||||||||||    ||||  c
3'   ca gaaagu  cgg ga auguuacgacg    ggac  a
   ac  a      au   -  c           aacu    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr20: 24380544-24380621 [-]
intergenic
Database links

Mature sequence ppy-miR-103

Accession MIMAT0002445
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Evidence not experimental

References

1