Stem-loop sequence ppy-mir-101-2

AccessionMI0014812 (change log)
DescriptionPongo pygmaeus miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
     ug  c                    c a    guaua 
5' ac  uc uuuuucgguuaucaugguac g ugcu     u
   ||  || |||||||||||||||||||| | ||||      
3' ug  gg aagaagucaauagugucaug c augg     c
     gu  u                    a -    aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 58132836-58132914 [-]
intergenic
Database links

Mature sequence ppy-miR-101

Accession MIMAT0002429
Sequence

49 - 

uacaguacugugauaacugaa

 - 69

Get sequence
Evidence not experimental

References

1