Stem-loop sequence ppy-mir-101-1

AccessionMI0014811 (change log)
DescriptionPongo pygmaeus miR-101-1 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   u   cuggc                  a    gucca 
5'  gcc     ucaguuaucacagugcug ugcu     u
    |||     |||||||||||||||||| ||||      
3'  cgg     agucaauagugucaugac augg     u
   a   uagga                  -    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 164325359-164325433 [+]
intergenic
Database links

Mature sequence ppy-miR-101

Accession MIMAT0002429
Sequence

47 - 

uacaguacugugauaacugaa

 - 67

Get sequence
Evidence not experimental

References

1