Stem-loop sequence ppy-mir-96

AccessionMI0014810 (change log)
DescriptionPongo pygmaeus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   ugg  g  u        a      uu      ---   uc 
5'    cc au uuggcacu gcacau  uugcuu   gug  u
      || || |||||||| ||||||  ||||||   |||   
3'    gg ua aaccguga cgugua  aacgag   cgc  c
   aaa  g  u        -      cu      ucu   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 126690695-126690772 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-96
ppy-mir-183chr7: 126690908-126691014 [-]
ppy-mir-96chr7: 126690695-126690772 [-]
ppy-mir-182chr7: 126686148-126686259 [-]
Database links

Mature sequence ppy-miR-96

Accession MIMAT0015745
Sequence

9 - 

uuuggcacuagcacauuuuugcu

 - 31

Get sequence
Evidence not experimental

References

1