Stem-loop sequence ppy-mir-92b

AccessionMI0014809 (change log)
DescriptionPongo pygmaeus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   c     cc   c    g     ga       c            uuuuu 
5'  gggcc  ggg gggc ggagg  cgggacg ggugcaguguug     u
    |||||  ||| |||| |||||  ||||||| ||||||||||||     c
3'  cccgg  ccu cccg ccucc  gcccugc ucacguuauaac     c
   -     --   c    g     -g       -            cgccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 96304094-96304189 [-]
intergenic
Database links

Mature sequence ppy-miR-92b

Accession MIMAT0015744
Sequence

61 - 

uauugcacucgucccggccucc

 - 82

Get sequence
Evidence not experimental

References

1