Stem-loop sequence ppy-mir-34c

AccessionMI0014808 (change log)
DescriptionPongo pygmaeus miR-34c stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
        ag     a   a    a     c      c  a 
5' agucu  uuacu ggc gugu guuag ugauug ua u
   |||||  ||||| ||| |||| ||||| |||||| ||  
3' uuaga  aaugg ccg caca caauc acuaac au a
        aa     a   g    c     -      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 108239300-108239376 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-34c
ppy-mir-34bchr11: 108238803-108238886 [+]
ppy-mir-34cchr11: 108239300-108239376 [+]
Database links

Mature sequence ppy-miR-34c-5p

Accession MIMAT0015742
Sequence

13 - 

aggcaguguaguuagcugauugc

 - 35

Get sequence
Evidence not experimental

Mature sequence ppy-miR-34c-3p

Accession MIMAT0015743
Sequence

46 - 

aaucacuaaccacacggccagg

 - 67

Get sequence
Evidence not experimental

References

1