Stem-loop sequence ppy-mir-34b

AccessionMI0014807 (change log)
DescriptionPongo pygmaeus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
        cg    -gua       uca    c        -  g 
5' gugcu  guuu    ggcagug   uuag ugauugua cu u
   |||||  ||||    |||||||   |||| |||||||| || g
3' cacgg  caaa    ccgucac   aauc acuaacau gg a
        aa    acua       cuc    -        u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 108238803-108238886 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-34b
ppy-mir-34bchr11: 108238803-108238886 [+]
ppy-mir-34cchr11: 108239300-108239376 [+]
Database links

Mature sequence ppy-miR-34b

Accession MIMAT0015741
Sequence

50 - 

caaucacuaacuccacugccau

 - 71

Get sequence
Evidence not experimental

References

1