Stem-loop sequence ppy-mir-33b

AccessionMI0014806 (change log)
DescriptionPongo pygmaeus miR-33b stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   --------------------------------------gcgaggcggcgcc           u 
5'                                                    cgcgugcaugc g
                                                      |||||||||||  
3'                                                    gugcacguacg u
   ccacgguccccggccgaggcccgacgugacggcuccgugacguggcgaguu           u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 18161891-18161980 [-]
intergenic
Database links

Mature sequence ppy-miR-33b

Accession MIMAT0015740
Sequence

17 - 

gugcaugcuguugcaugcac

 - 36

Get sequence
Evidence not experimental

References

1