Stem-loop sequence ppy-mir-30e

AccessionMI0014805 (change log)
DescriptionPongo pygmaeus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   g        uu  ua            uu           g aag u 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   g g
    ||||||||  ||  ||||||||||||  ||||||||||| |   |  
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g   c u
   a        --  gc            --           g aga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 189333513-189333604 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-30e
ppy-mir-30echr1: 189333513-189333604 [-]
ppy-mir-30c-1chr1: 189330565-189330653 [-]
Database links

Mature sequence ppy-miR-30e

Accession MIMAT0015739
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Evidence not experimental

References

1