Stem-loop sequence ppy-mir-30d

AccessionMI0014804 (change log)
DescriptionPongo pygmaeus miR-30d stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   guu  u         ccc           gua  ac 
5'    gu guaaacauc   gacuggaagcu   ag  a
      || |||||||||   |||||||||||   ||   
3'    cg cguuuguag   cugacuuucga   uc  c
   cau  u         --a           --a  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 142869803-142869872 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-30d
ppy-mir-30dchr8: 142869803-142869872 [-]
ppy-mir-30bchr8: 142865078-142865165 [-]
Database links

Mature sequence ppy-miR-30d

Accession MIMAT0015738
Sequence

6 - 

uguaaacauccccgacuggaag

 - 27

Get sequence
Evidence not experimental

References

1