Stem-loop sequence ppy-mir-30c-1

AccessionMI0014803 (change log)
DescriptionPongo pygmaeus miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   a     cu    ugu u       u   aca         ---g  a 
5'  ccaug  guag   g guaaaca ccu   cucucagcu    ug g
    |||||  ||||   | ||||||| |||   |||||||||    ||  
3'  gguac  cguc   c cauuugu ggg   gagggucgg    ac c
   a     --    uuc u       u   --a         ugga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 189330565-189330653 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-30c-1
ppy-mir-30echr1: 189333513-189333604 [-]
ppy-mir-30c-1chr1: 189330565-189330653 [-]
Database links

Mature sequence ppy-miR-30c

Accession MIMAT0015737
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Evidence not experimental

References

1