Stem-loop sequence ppy-mir-30b

AccessionMI0014802 (change log)
DescriptionPongo pygmaeus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   a     uu      cau          u  -a        uaaua 
5'  ccaag  ucaguu   guaaacaucc ac  cucagcug     c
    |||||  ||||||   |||||||||| ||  ||||||||      
3'  gguuc  agucga   cauuuguagg ug  gggucggu     a
   a     --      cuu          -  ga        uaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 142865078-142865165 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-30b
ppy-mir-30dchr8: 142869803-142869872 [-]
ppy-mir-30bchr8: 142865078-142865165 [-]
Database links

Mature sequence ppy-miR-30b

Accession MIMAT0015736
Sequence

17 - 

uguaaacauccuacacucagcu

 - 38

Get sequence
Evidence not experimental

References

1