Stem-loop sequence ppy-mir-29c

AccessionMI0014801 (change log)
DescriptionPongo pygmaeus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 42328128-42328215 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-29c
ppy-mir-29b-2chr1: 42327544-42327624 [+]
ppy-mir-29cchr1: 42328128-42328215 [+]
Database links

Mature sequence ppy-miR-29c

Accession MIMAT0015735
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Evidence not experimental

References

1