Stem-loop sequence ppy-mir-27b

AccessionMI0014800 (change log)
DescriptionPongo pygmaeus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   -    -    aaca                  auug        ugau     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 91048811-91048907 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-27b
ppy-mir-23bchr9: 91048574-91048670 [+]
ppy-mir-27bchr9: 91048811-91048907 [+]
ppy-mir-24-1chr9: 91049387-91049454 [+]
Database links

Mature sequence ppy-miR-27b

Accession MIMAT0015734
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Evidence not experimental

References

1