Stem-loop sequence ppy-mir-26b

AccessionMI0014799 (change log)
DescriptionPongo pygmaeus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
       ga   -   u        uc           u ug 
5' ccgg  ccc agu caaguaau  aggauagguug g  c
   ||||  ||| ||| ||||||||  ||||||||||| |   
3' ggcc  ggg ucg guucauua  ucuuguccgac c  u
       ag   c   -        cc           - ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2B: 110251998-110252074 [+]
intergenic
Database links

Mature sequence ppy-miR-26b

Accession MIMAT0015733
Sequence

12 - 

uucaaguaauucaggauaggu

 - 32

Get sequence
Evidence not experimental

References

1