Stem-loop sequence ppy-mir-26a-2

AccessionMI0014798 (change log)
DescriptionPongo pygmaeus miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
         gg ug  uu         c          guuucc 
5' ggcugu  c  ga  caaguaauc aggauaggcu      a
   ||||||  |  ||  ||||||||| ||||||||||       
3' ucgacg  g  cu  guucauuag ucuuauccgg      u
         ga gu  uu         u          aguguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr12: 57656729-57656812 [-]
intergenic
Database links

Mature sequence ppy-miR-26a

Accession MIMAT0002346
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Evidence not experimental

References

1