Stem-loop sequence ppy-mir-20b

AccessionMI0014797 (change log)
DescriptionPongo pygmaeus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
        -ca           g     -gu    uu 
5' aguac   aagugcucaua ugcag   aguu  g
   |||||   ||||||||||| |||||   ||||  g
3' ucaug   uucacggguau auguc   ucag  c
        acc           g     auc    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 133612734-133612802 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-20b
ppy-mir-106achrX: 133613123-133613203 [-]
ppy-mir-18bchrX: 133612966-133613036 [-]
ppy-mir-20bchrX: 133612734-133612802 [-]
ppy-mir-19b-2chrX: 133612596-133612691 [-]
ppy-mir-92-2chrX: 133612463-133612537 [-]
ppy-mir-363chrX: 133612303-133612377 [-]
Database links

Mature sequence ppy-miR-20b

Accession MIMAT0015732
Sequence

6 - 

caaagugcucauagugcagguag

 - 28

Get sequence
Evidence not experimental

References

1