Stem-loop sequence ppy-mir-16-2

AccessionMI0014795 (change log)
DescriptionPongo pygmaeus miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
     uc    cu         ua        - cg     aa 
5' gu  cacu  agcagcacg  aauauugg g  uagug  a
   ||  ||||  |||||||||  |||||||| |  |||||  u
3' ca  guga  ucgucgugu  uuauaacc c  auuau  a
     gu    uu         ca        a aa     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 163674255-163674336 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-16-2
ppy-mir-15bchr3: 163674098-163674195 [+]
ppy-mir-16-2chr3: 163674255-163674336 [+]
Database links

Mature sequence ppy-miR-16

Accession MIMAT0002653
Sequence

10 - 

uagcagcacguaaauauugg

 - 29

Get sequence
Evidence not experimental

References

1