Stem-loop sequence ppy-mir-10b

AccessionMI0014794 (change log)
DescriptionPongo pygmaeus miR-10b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   cca      guaa     u        a    g     c          -ug   u 
5'    gagguu    cguug cuauauau cccu uagaa cgaauuugug   gua c
      ||||||    ||||| |||||||| |||| ||||| ||||||||||   |||  
3'    cuucaa    guagc gguauaua gggg aucuu gcuuagacac   uau c
   --a      aaac     u        a    -     a          uga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2B: 66307708-66307817 [+]
intergenic
Database links

Mature sequence ppy-miR-10b

Accession MIMAT0015730
Sequence

27 - 

uacccuguagaaccgaauuugug

 - 49

Get sequence
Evidence not experimental

References

1