Stem-loop sequence ppy-mir-9-3

AccessionMI0014793 (change log)
DescriptionPongo pygmaeus miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   g    cc       -  c               g     gu  ca 
5'  gagg  cguuucu cu uuugguuaucuagcu uauga  gc  c
    ||||  ||||||| || ||||||||||||||| |||||  ||   
3'  cucu  guaaaga ga aagccaauagaucga auacu  cg  a
   a    ca       u  -               a     gc  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr15: 86027137-86027226 [+]
intergenic
Database links

Mature sequence ppy-miR-9

Accession MIMAT0015729
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence not experimental

References

1