Stem-loop sequence ppy-mir-9-2

AccessionMI0014792 (change log)
DescriptionPongo pygmaeus miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   g    u     g   uc               g      ug a 
5'  gaag gaguu uua  uuugguuaucuagcu uaugag  u u
    |||| ||||| |||  ||||||||||||||| ||||||  |  
3'  cuuc cucaa aau  aagccaauagaucga auacuu  g u
   a    -     a   ga               a      cu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 89207834-89207920 [-]
intergenic
Database links

Mature sequence ppy-miR-9

Accession MIMAT0015729
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence not experimental

References

1