Stem-loop sequence ppy-mir-9-1

AccessionMI0014791 (change log)
DescriptionPongo pygmaeus miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   c       guug   uc               g      u  ug 
5'  gggguug    uua  uuugguuaucuagcu uaugag gg  u
    |||||||    |||  ||||||||||||||| |||||| ||  g
3'  ccccaau    aau  aagccaauagaucga auacuu cu  g
   a       -aaa   ga               a      -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 95096290-95096378 [+]
intergenic
Database links

Mature sequence ppy-miR-9

Accession MIMAT0015729
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence not experimental

References

1