Stem-loop sequence ppy-mir-7-3

AccessionMI0014790 (change log)
DescriptionPongo pygmaeus miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   agauua   u  cugu     a        u  aa a  a       u      c  au 
5'       gag gg    ggucu gugcugug gg  g cu gugauuu guuguu ug  g
         ||| ||    ||||| |||||||| ||  | || ||||||| |||||| ||   
3'       cuu cc    ucaga cgcgauac cc  c ga cacugaa caacag au  u
   ---cag   c  ----     -        u  gg c  -       -      u  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 4761097-4761206 [+]
intergenic
Database links

Mature sequence ppy-miR-7

Accession MIMAT0002480
Sequence

31 - 

uggaagacuagugauuuuguu

 - 51

Get sequence
Evidence not experimental

References

1