Stem-loop sequence ppy-let-7i

AccessionMI0014789 (change log)
DescriptionPongo pygmaeus let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7i
(4 sentences)

Stem-loop
   c    u                 u   --------  u     ugu 
5'  uggc gagguaguaguuugugc guu        gg cgggu   g
    |||| ||||||||||||||||| |||        || |||||   a
3'  aucg uuccgucaucgaacgcg caa        uc gcccg   c
   -    -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr12: 62645578-62645661 [+]
intergenic
Database links

Mature sequence ppy-let-7i

Accession MIMAT0015728
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Evidence not experimental

References

1