Stem-loop sequence ppy-let-7g

AccessionMI0014788 (change log)
DescriptionPongo pygmaeus let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7g
(5 sentences)

Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   a   -        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 94085884-94085967 [+]
intergenic
Database links

Mature sequence ppy-let-7g

Accession MIMAT0015727
Sequence

5 - 

ugagguaguaguuuguacaguu

 - 26

Get sequence
Evidence not experimental

References

1