Stem-loop sequence ppy-let-7f-2

AccessionMI0014787 (change log)
DescriptionPongo pygmaeus let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7f-2
(5 sentences)

Stem-loop
   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   g      -   ug                uagagguucuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 53954914-53954996 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7f-2
ppy-let-7f-2chrX: 53954914-53954996 [-]
ppy-mir-98chrX: 53953964-53954043 [-]
Database links

Mature sequence ppy-let-7f

Accession MIMAT0015726
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Evidence not experimental

References

1