Stem-loop sequence ppy-let-7f-1

AccessionMI0014786 (change log)
DescriptionPongo pygmaeus let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7f-1
(5 sentences)

Stem-loop
       a ug                      ---------       u 
5' ucag g  agguaguagauuguauaguugu         gggguag g
   |||| |  ||||||||||||||||||||||         ||||||| a
3' aguc c  uccguuaucuaacauaucaaua         ucccauu u
       - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 89895138-89895224 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7f-1
ppy-let-7a-1chr9: 89894747-89894826 [+]
ppy-let-7f-1chr9: 89895138-89895224 [+]
ppy-let-7dchr9: 89897633-89897719 [+]
Database links

Mature sequence ppy-let-7f

Accession MIMAT0015726
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Evidence not experimental

References

1