Stem-loop sequence ppy-let-7e

AccessionMI0014785 (change log)
DescriptionPongo pygmaeus let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7e
(4 sentences)

Stem-loop
     c   cu   g                u  ----gga  a 
5' cc ggg  gag uaggagguuguauagu ga       gg c
   || |||  ||| |||||||||||||||| ||       ||  
3' gg ccc  uuc auccuccggcauauca cu       cc a
     a   cu   g                -  agaggaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 53226596-53226674 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7e
ppy-let-7echr19: 53226596-53226674 [+]
ppy-mir-125achr19: 53227066-53227151 [+]
Database links

Mature sequence ppy-let-7e

Accession MIMAT0015725
Sequence

8 - 

ugagguaggagguuguauaguu

 - 29

Get sequence
Evidence not experimental

References

1