Stem-loop sequence ppy-let-7e

Accession MI0014785
Description Pongo pygmaeus let-7e stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  c   cu   g                u  ----gga  a 
cc ggg  gag uaggagguuguauagu ga       gg c
|| |||  ||| |||||||||||||||| ||       ||  
gg ccc  uuc auccuccggcauauca cu       cc a
  a   cu   g                -  agaggaa  c 
Get sequence
Genome context
Coordinates (PPYG2) Overlapping transcripts
19: 53226596-53226674 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7e
ppy-let-7e 19: 53226596-53226674 [+]
ppy-mir-125a 19: 53227066-53227151 [+]

Mature sequence ppy-let-7e

Accession MIMAT0015725
Sequence

8 - 

ugagguaggagguuguauaguu

 - 29

Get sequence
Evidence not experimental

References

1