Stem-loop sequence ppy-let-7d

AccessionMI0014784 (change log)
DescriptionPongo pygmaeus let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7d
(4 sentences)

Stem-loop
          a              c      uuagggcagggauu 
5' ccuagga gagguaguagguug auaguu              u
   ||||||| |||||||||||||| ||||||               
3' ggauucu uuccgucguccagc uaucaa              u
          -              a      uggaggaacacccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 89897633-89897719 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7d
ppy-let-7a-1chr9: 89894747-89894826 [+]
ppy-let-7f-1chr9: 89895138-89895224 [+]
ppy-let-7dchr9: 89897633-89897719 [+]
Database links

Mature sequence ppy-let-7d

Accession MIMAT0015724
Sequence

8 - 

agagguaguagguugcauaguu

 - 29

Get sequence
Evidence not experimental

References

1