Stem-loop sequence ppy-let-7c

AccessionMI0014783 (change log)
DescriptionPongo pygmaeus let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7c
(4 sentences)

Stem-loop
     a      uu   g   u             ua  g ua a 
5' gc uccggg  gag uag agguuguaugguu  ga u  c c
   || ||||||  ||| ||| |||||||||||||  || |  | c
3' cg agguuc  uuc auc uccaacaugucaa  uu a  g c
     -      cu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr21: 16253338-16253421 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7c
ppy-mir-99achr21: 16252606-16252686 [+]
ppy-let-7cchr21: 16253338-16253421 [+]
Database links

Mature sequence ppy-let-7c

Accession MIMAT0015723
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Evidence not experimental

References

1