Stem-loop sequence ppy-let-7b

AccessionMI0014782 (change log)
DescriptionPongo pygmaeus let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7b
(4 sentences)

Stem-loop
        u                     ----  ---a      u 
5' cgggg gagguaguagguugugugguu    uc    gggcag g
   ||||| |||||||||||||||||||||    ||    |||||| a
3' guccc uuccgucauccaacauaucaa    ag    cccguu u
        -                     uaga  acuc      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr22: 41541671-41541753 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7b
ppy-let-7a-3chr22: 41540745-41540818 [+]
ppy-let-7bchr22: 41541671-41541753 [+]
Database links

Mature sequence ppy-let-7b

Accession MIMAT0015722
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Evidence not experimental

References

1