Stem-loop sequence ppy-let-7a-3

AccessionMI0014781 (change log)
DescriptionPongo pygmaeus let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7a-3
(5 sentences)

Stem-loop
      u   gu                ---------        
5' ggg gag  aguagguuguauaguu         uggggcu 
   ||| |||  ||||||||||||||||         |||||| c
3' ucc uuc  ucaucuaacauaucaa         gucccgu 
      u   ug                uaggguauc        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr22: 41540745-41540818 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7a-3
ppy-let-7a-3chr22: 41540745-41540818 [+]
ppy-let-7bchr22: 41541671-41541753 [+]
Database links

Mature sequence ppy-let-7a

Accession MIMAT0015721
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Evidence not experimental

References

1