Stem-loop sequence ppy-let-7a-2

AccessionMI0014780 (change log)
DescriptionPongo pygmaeus let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ppy-let-7a-2
(5 sentences)

Stem-loop
      uu   g   u             uagaa ua a 
5' agg  gag uag agguuguauaguu     u  c u
   |||  ||| ||| |||||||||||||     |  | c
3' ucc  uuc auc uccgacaugucaa     a  g a
      -u   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 119102471-119102542 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-let-7a-2
ppy-mir-100chr11: 119108173-119108252 [-]
ppy-let-7a-2chr11: 119102471-119102542 [-]
Database links

Mature sequence ppy-let-7a

Accession MIMAT0015721
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Evidence not experimental

References

1