Stem-loop sequence ppy-mir-1-1

AccessionMI0014778 (change log)
DescriptionPongo pygmaeus miR-1-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   u    a                gc     ---   a 
5'  ggga acauacuucuuuauau  ccaua   ugg c
    |||| ||||||||||||||||  |||||   ||| c
3'  cucu uguaugaagaaaugua  gguau   auc u
   a    a                -a     cga   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr20: 60885111-60885181 [+]
intergenic
Database links

Mature sequence ppy-miR-1

Accession MIMAT0015720
Sequence

46 - 

uggaauguaaagaaguauguau

 - 67

Get sequence
Evidence not experimental

References

1