Stem-loop sequence ssc-mir-376a

AccessionMI0014775 (change log)
DescriptionSus scrofa miR-376a stem-loop
Gene family MIPF0000091; mir-368
Literature search

4 open access papers mention ssc-mir-376a
(5 sentences)

Stem-loop
         u    g  a    c    u      guacauua 
5' gguauu aaaa gu gauu uccu cuauga        u
   |||||| |||| || |||| |||| ||||||        u
3' cuauga uuuu ca cuaa agga gauacu        u
         c    g  c    a    -      aauuauua 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf2115: 30857-30936 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-376a
ssc-mir-376cchrUScaf2115: 32036-32113 [-]
ssc-mir-376achrUScaf2115: 30857-30936 [-]
ssc-mir-381chrUScaf2115: 27138-27219 [-]
Database links

Mature sequence ssc-miR-376a-5p

Accession MIMAT0015715
Previous IDsssc-miR-376a*
Sequence

13 - 

guagauucuccuucuaugaguac

 - 35

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence ssc-miR-376a-3p

Accession MIMAT0015716
Previous IDsssc-miR-376a
Sequence

50 - 

aucauagaggaaaauccacgu

 - 70

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence by similarity; MI0010457

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).