Stem-loop sequence ssc-mir-369

AccessionMI0014774 (change log)
DescriptionSus scrofa miR-369 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention ssc-mir-369
(1 sentences)

Stem-loop
   u   ag               ua      cuuuau      u  ag               ua      cuu g 
5'  uga  ggagaucgaccgugu  uauucg      gguacu ga  ggagaucgaccgugu  uauucg   g c
    |||  |||||||||||||||  ||||||      |||||| ||  |||||||||||||||  ||||||   | u
3'  acu  uuucuaguugguaca  auaagc      cuauga cu  uuucuaguugguaca  auaagc   c g
   g   cu               ua      uucagu      -  cu               ua      -uu a 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-369

Accession MIMAT0015714
Sequence

123 - 

aauaauacaugguugaucuuu

 - 143

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence experimental; cloned [1]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).