Stem-loop sequence ssc-mir-338

AccessionMI0014773 (change log)
DescriptionSus scrofa miR-338 stem-loop
Gene family MIPF0000097; mir-338
Literature search

5 open access papers mention ssc-mir-338
(12 sentences)

Stem-loop
   cc      cc      u   -         -   ga  a 
5'   guccuc  caacaa auc cuggugcug agu  ug c
     ||||||  |||||| ||| ||||||||| |||  || a
3'   cgggag  guuguu uag gacuacgac uca  gc c
   ga      aa      u   u         c   ac  a 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 1507084-1507162 [+]
sense
ENSSSCT00000026374 ; ssc-mir-338.1-201; exon 1
ENSSSCT00000023391 ; AATK-201; intron 7
ENSSSCT00000018660 ; AATK-202; intron 7
Database links

Mature sequence ssc-miR-338

Accession MIMAT0015713
Sequence

48 - 

uccagcaucagugauuuuguug

 - 69

Get sequence
Deep sequencing14 reads, 4 experiments
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).