Stem-loop sequence ssc-mir-299

AccessionMI0014772 (change log)
DescriptionSus scrofa miR-299 stem-loop
Gene family MIPF0000186; mir-299
Stem-loop
   c      ug     a                      uu 
5'  gguacu  aagaa ugguuuaccgucccacauacau  u
    ||||||  ||||| ||||||||||||||||||||||  g
3'  cuaugg  uucuu gccaaauggcaggguguaugua  c
   c      --     c                      ua 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-299

Accession MIMAT0015712
Sequence

15 - 

augguuuaccgucccacauac

 - 35

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).