Stem-loop sequence ssc-mir-363-1

AccessionMI0014771 (change log)
Previous IDsssc-mir-363
DescriptionSus scrofa miR-363-1 stem-loop
Gene family MIPF0000138; mir-363
Literature search

6 open access papers mention ssc-mir-363-1
(20 sentences)

Stem-loop
   -  u   gu         ca  a         --ga   gu 
5'  gc guu  cggguggau  cg ugcaauuuu    uua  a
    || |||  |||||||||  || |||||||||    |||   
3'  cg caa  gucuaccua  gc acguuaaaa    gau  u
   a  c   au         ug  -         agag   ac 
Get sequence
Deep sequencing
264 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 126199347-126199426 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-363-1
ssc-mir-106achrX: 126200183-126200263 [-]
ssc-mir-18bchrX: 126200019-126200101 [-]
ssc-mir-20b-1chrX: 126199775-126199854 [-]
ssc-mir-19b-2chrX: 126199650-126199729 [-]
ssc-mir-92a-2chrX: 126199512-126199591 [-]
ssc-mir-363-1chrX: 126199347-126199426 [-]
Database links

Mature sequence ssc-miR-363

Accession MIMAT0015711
Sequence

52 - 

aauugcacgguauccaucuguaa

 - 74

Get sequence
Deep sequencing528 reads, 13 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).