Stem-loop sequence nvi-mir-3478

AccessionMI0014768 (change log)
DescriptionNasonia vitripennis miR-3478 stem-loop
Gene family MIPF0002075; mir-3478
Stem-loop
   g      aua    -au      ua cc   g   uauuu 
5'  aggcug   uugg   gaaucc  c  ggu agg     a
    ||||||   ||||   ||||||  |  ||| |||      
3'  uccgac   agcc   cuuagg  g  cca ucc     u
   -      gac    cac      gc aa   a   uuuaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL341018.1: 1808213-1808292 [+]
intergenic
Database links

Mature sequence nvi-miR-3478

Accession MIMAT0015707
Sequence

10 - 

auuggaugaauccuacccggugag

 - 33

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).