Stem-loop sequence nvi-mir-3477

AccessionMI0014767 (change log)
DescriptionNasonia vitripennis miR-3477 stem-loop
Gene family MIPF0001227; mir-3477
Stem-loop
          ucu   ua  u         c     c       --gu  g 
5' gguagug   gug  gg aaucucaug gguaa ugugagc    gu a
   |||||||   |||  || ||||||||| ||||| |||||||    || a
3' ccaucac   cac  cc uuagggugc ccauu auacucg    ca a
          --c   --  u         u     -       guau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL340882.1: 830357-830448 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-3477
nvi-mir-283GL340882.1: 829662-829763 [+]
nvi-mir-3477GL340882.1: 830357-830448 [+]
nvi-mir-12GL340882.1: 830969-831052 [+]
Database links

Mature sequence nvi-miR-3477

Accession MIMAT0015706
Sequence

60 - 

cauauuaccucgugggauuuc

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).