Stem-loop sequence nvi-mir-928

AccessionMI0014766 (change log)
DescriptionNasonia vitripennis miR-928 stem-loop
Gene family MIPF0000950; mir-928
Stem-loop
   -----------------------------------     guacuc        --  aa   c   aa 
5'                                    gucca      guggcugu  gg  gcu gcg  c
                                      |||||      ||||||||  ||  ||| |||  g
3'                                    caggu      uaucgaca  cc  uga cgc  u
   caggccggugcucgaggccgcggcacgagcgcaag     ---auc        uu  gc   -   ag 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL341019.1: 2230534-2230633 [-]
intergenic
Database links

Mature sequence nvi-miR-928

Accession MIMAT0015705
Sequence

12 - 

guggcuguggaagcucgcgaa

 - 32

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).