Stem-loop sequence nvi-mir-993

AccessionMI0014765 (change log)
DescriptionNasonia vitripennis miR-993 stem-loop
Gene family MIPF0000033; mir-10
   gcgagagacgacgguguuugcgaaagauaggcacauucgugaucuac        uc          uagaau 
5'                                                ccuguaga  cgggcuuuug      u
                                                  ||||||||  ||||||||||      g
3'                                                ggacaucu  gcucgaagac      u
   ------------------------------uacaguaggcauucuau        cu          uauaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 6913427-6913545 [-]
Database links

Mature sequence nvi-miR-993

Accession MIMAT0015704

85 - 


 - 107

Get sequence
Evidence experimental; 454 [1]


PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).