Stem-loop sequence nvi-bantam

AccessionMI0014757 (change log)
DescriptionNasonia vitripennis bantam stem-loop
Gene family MIPF0000153; bantam
Stem-loop
   -----auaua       cu                 ga    ugua 
5'           gacgaaa  gguuuucacaaugauuu  caga    u
             |||||||  |||||||||||||||||  ||||     
3'           uuguuuu  ucgaaaguguuacuaga  gucu    u
   gacuuaagcc       ag                 --    uagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr3: 7456787-7456873 [+]
intergenic
Database links

Mature sequence nvi-bantam

Accession MIMAT0015696
Sequence

50 - 

ugagaucauugugaaagcugauu

 - 72

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).